Erratum to “cis-acting DNA regulatory elements, including the retinoic acid response element, are required for tissue specific laminin B1 promoter/lacZ expression in transgenic mice” [Mech. Dev. 103 (2001) 13–25]

Sox-5 NNAACAATNN CCAACAATGC 21570 ! v-Myb N(C/G)(C/T)AACGGX GCCGTTGGG 21968 21304 ! à Ik-2 NNN(C/T)GGGA(A/T)NNN CGTTGGGAATCC 21301 ! HNF-1 NGTTAAT(G/T)A(A/T)TNACCA(A/C) TTGGAGAATAATTAACACAG 21232 à S8 (A/T)NNAN(C/T)(C/T)AATTAN(C/T)NN TTGGAGAATAATTAACACAG 21230 à GATA-1 (C/G)NNGATNNNN ACTGACCAATCAGC 21971 21127 ! à NF-Y NCTGATTGG(C/T)TA(C/G)(C/T) ACTGACCAATCAGC 21129 à Nkx-2 T(C/T)AAGTG CACTTAA 2912 à AML-la T(G/C)TGGT TGTGGT 22222 21693 ! ! 21639 2978 2568 à ! à SRY AAAC(A/T)A(A/C) TT(T/A)GTTT 21892 21886 2171 à à ! MZF-1 NGNGGGGA TCCCCAGT 2943 à NGF-1c (A/T)TGCGTGGG(C/T)GG CCCACCCACGCAA 2549 à a Factor binding DNA motif search was performed using the search engine TFSEARCH ver. 1.3 in the TRANSFAC database, GBF-Braunschweig, Germany. LAMB 1 sequences are as they appear 5 0±3 0 in the sense strand. Forward or reverse orientation of the DNA motifs is shown by the arrows below their locations. Nˆ any nucleotide; XˆA, C, or T. Mechanisms of Development 107 (2001) 207