Erratum to “cis-acting DNA regulatory elements, including the retinoic acid response element, are required for tissue specific laminin B1 promoter/lacZ expression in transgenic mice” [Mech. Dev. 103 (2001) 13–25]

نویسندگان

  • Karim A. Sharif
  • Congyi Li
  • Lorraine J. Gudas
چکیده

Sox-5 NNAACAATNN CCAACAATGC 21570 ! v-Myb N(C/G)(C/T)AACGGX GCCGTTGGG 21968 21304 ! à Ik-2 NNN(C/T)GGGA(A/T)NNN CGTTGGGAATCC 21301 ! HNF-1 NGTTAAT(G/T)A(A/T)TNACCA(A/C) TTGGAGAATAATTAACACAG 21232 à S8 (A/T)NNAN(C/T)(C/T)AATTAN(C/T)NN TTGGAGAATAATTAACACAG 21230 à GATA-1 (C/G)NNGATNNNN ACTGACCAATCAGC 21971 21127 ! à NF-Y NCTGATTGG(C/T)TA(C/G)(C/T) ACTGACCAATCAGC 21129 à Nkx-2 T(C/T)AAGTG CACTTAA 2912 à AML-la T(G/C)TGGT TGTGGT 22222 21693 ! ! 21639 2978 2568 à ! à SRY AAAC(A/T)A(A/C) TT(T/A)GTTT 21892 21886 2171 à à ! MZF-1 NGNGGGGA TCCCCAGT 2943 à NGF-1c (A/T)TGCGTGGG(C/T)GG CCCACCCACGCAA 2549 à a Factor binding DNA motif search was performed using the search engine TFSEARCH ver. 1.3 in the TRANSFAC database, GBF-Braunschweig, Germany. LAMB 1 sequences are as they appear 5 0±3 0 in the sense strand. Forward or reverse orientation of the DNA motifs is shown by the arrows below their locations. Nˆ any nucleotide; XˆA, C, or T. Mechanisms of Development 107 (2001) 207

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

cis-acting DNA regulatory elements, including the retinoic acid response element, are required for tissue specific laminin B1 promoter/lacZ expression in transgenic mice

The LAMB1 gene encodes the laminin beta1 subunit of laminin, an extracellular matrix protein. Using several transgenic mouse lines containing various lengths of the LAMB1 promoter driving lacZ reporter gene expression, regions of LAMB1 promoter that contain cis-acting DNA regulatory element(s) have been identified. The 3.9LAMB1betagal transgene is expressed in various tissues during development...

متن کامل

Retinoic acid and methylation cis-regulatory elements control the mouse tissue non-specific alkaline phosphatase gene expression

To understand the mechanisms regulating the tissue non-specific alkaline phosphatase (TNAP) activity during development, we characterized cis-transcriptional regulatory elements. In embryonic cells and tissues, TNAP expression was driven preferentially by the exon 1A (E1A) promoter, one of the two promoters previously defined. Transcriptional activity of E1A promoter was up-regulated by retinoi...

متن کامل

Selectable Marker Gene Removal and Expression of Transgene by Inducible Promoter Containing FFDD Cis-Acting elements in Transgenic plants

Abstract Background: Selectable marker gene (SMG) systems are critical for generation of transgenic crops. Transgenic crop production Background: Selectable marker gene (SMG) systems are critical for generation of transgenic crops. Transgenic crop production without using SMG is not economically feasible. However, SMGs are non-essential once an intact transgenic plant has been established. Eli...

متن کامل

Expression of the murine Hoxa4 gene requires both autoregulation and a conserved retinoic acid response element.

Analysis of the regulatory regions of the Hox genes has revealed a complex array of positive and negative cis-acting elements that control the spatial and temporal pattern of expression of these genes during embryogenesis. In this study we show that normal expression of the murine Hoxa4 gene during development requires both autoregulatory and retinoic acid-dependent modes of regulation. When in...

متن کامل

Evaluation of MYB93 and MAD8 Genes in Transgenic and Non-Transgenic Rice

Increasing drought tolerance, especially in rice, which is one of the most important crops in Asia, is necessary. Transcription factors are specific sequence DNA-binding proteins that are capable of activating or suppressing transcription. These proteins regulate gene expression levels by binding to cis regulatory elements in the promoter of target genes to control various biological processes ...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:
  • Mechanisms of Development

دوره 107  شماره 

صفحات  -

تاریخ انتشار 2001